A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: CW0013Publication date: 01/2000
PMID: 10652997GI: 562277 Taxonomy ID: 10385
Virus Name: Bovine herpesvirus 4, BHV4 Product size (PCR):
bp
MgCl2: 1.5 mMdNTPs: mMType: Multiplex PCR
Temp (PCR cycle):(94C 1min>55C 1.5min>72C 2min)*35
Buffer: 1x PCR Buffer, 5microL glycercol
Polymerase: 0.02U/microL Taq poly (Perkin Elmer)Cycler: DNA thermal cycler (Perkin-Elmer-Cetus)
Note: Total PCR volume is 50microL containing DNA and 0.1microM each primer.

Total liquid hybridization is performed in a total volume of 25microL using 7microL PCR product in 50mM Tris (pH 8.0) buffer containing 1.2M NaCl, 100microM dNTPs, 60% formamide, 10^5cpm of 32P-labeled probe.
Hybridization temperature: 97C 5min>room temperature 15min.
Forward(P1) primer
Oligo type: PCRDegeneracy: 1
Target: 6153-6173Tm: 74.4 C at salt 1000.0mMLength:
Sequence: TGAGACATCTGGGAGTGCTTC
(0 other experimental conditions)
Note:
Reverse(P2) primer
Oligo type: PCRDegeneracy: 1
Target: 6423-6404Tm: 74.1 C at salt 1000.0mMLength:
Sequence: CTCCTTCACTTCTGCCAGTG
(0 other experimental conditions)
Note:
Forward(CW00132) primer
Oligo type: HybridizationDegeneracy: 1
Target: 6269-6298Tm: 83.4 C at salt 1000.0mMLength:
Sequence: GCTCTGGAGTCACTCTGTCTGTGTGTGATG
(0 other experimental conditions)
Note: This oligonucleotide is used as hybridization probe.
Forward(CW00133) primer
Oligo type: PCRDegeneracy: 1
Target: 6153,6207-6173,6225Tm: 88.6 C at salt 1000.0mMLength:
Sequence: TGAGACATCTGGGAGTGCTTCTGCCAGGGTCACTTGC
(0 other experimental conditions)
Note: These Primers were used as the coamplified internal control.
Paired with CW000134
Reverse(CW00134) primer
Oligo type:
Degeneracy: 1
Target: 6423,6357-6404,6336Tm: 89.7 C at salt 1000.0mMLength:
Sequence: CTCCTTCACTTCTGCCAGTGTTACCTGGGCATCCCCACATTC
(0 other experimental conditions)
Note: These Primers were used as the coamplified internal control.
Paired with CW000133
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.