A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: CW0009Publication date: 09/97
PMID: 9261403GI: 9629818 Taxonomy ID: 10320
Virus Name: Bovine herpesvirus 1, BHV 1Product size (PCR): N/A bp
MgCl2: 1.5 mMdNTPs: mMType: PCR
Temp (PCR cycle):(95C 1min>65C 1min>72C 2min)*40
Buffer: 1x Commerical PCR buffer
Polymerase: 0.66 U/microL Taq polyCycler: N/A
Note: 0.5 mM more MgCl2 than CW0004
0.33 U/microL more taq poly than CW0004
Forward(CW00090) primer
Oligo type: PCRDegeneracy: 1
Target: N/A-N/ATm: 80.2 C at salt 1000.0mMLength:
Sequence: GCCGCCGTACTGGACATGCG
(0 other experimental conditions)
Note: Specific to TK Transcript
Reverse(CW00091) primer
Oligo type: PCRDegeneracy: 1
Target: N/A-N/ATm: 80.3 C at salt 1000.0mMLength:
Sequence: GCCGAGTCCCCGTAAGGCGAT
(0 other experimental conditions)
Note: Specific to TK Transcript
Forward(CW00092) primer
Oligo type:
Degeneracy: 1
Target: N/A-N/ATm: 83.7 C at salt 1000.0mMLength:
Sequence: CGCGTCAGTTCGCGCTAGAGATGGC
(0 other experimental conditions)
Note: Hybridiazation probe specific to TK Transcript
Pre-hybridization: 63C 60 min in 1x SSPE (150 mM NaCl,10 mM NaH2PO4, 1mM EDTA; PH7), 0.2xBP (1XBP is 2% bovine serum albumin, 2% polyvinylpyrolidone) plus 1%SDS.
Hybridization: 62C 180 min in1x SSPE-0.2XBP-1%SDS
Post-Hybridization: Wash at Room temperature for 5min in 0.005 SSPE-0.05%SDS three times.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.