A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: CW0006Publication date: 09/97
PMID: 9261403GI: 9629818 Taxonomy ID: 10320
Virus Name: Bovine herpesvirus 1, BHV 1Product size (PCR): N/A bp
MgCl2: 1.0 mMdNTPs: mMType: PCR
Temp (PCR cycle):(95C 1min> 65C 1min> 72C 2min)*40
Buffer: 1x Commerical PCR buffer
Polymerase: 0.33 U/microL Taq polyCycler: N/A
Note: Same conditions as CW0004
Forward(CW00060) primer
Oligo type: PCRDegeneracy: 1
Target: 129709-129729Tm: 80.3 C at salt 1000.0mMLength:
Sequence: ACTGCAACACCTGCCGCTGCC
(0 other experimental conditions)
Note: specific to IETU1/E1 transcript
Reverse(CW00061) primer
Oligo type: PCRDegeneracy: 1
Target: 129900-129879Tm: 80.3 C at salt 1000.0mMLength:
Sequence: TTCTGCTCCTTCGTCCCCGCTG
(0 other experimental conditions)
Note: specific to IETU1/E1 transcript
Forward(CW00062) primer
Oligo type: HybridizationDegeneracy: 1
Target: 129881-129901Tm: 82.1 C at salt 1000.0mMLength:
Sequence: GCGGGGACGAAGGAGCAGAAAAGC
(0 other experimental conditions)
Note: Hybridization probe specific to IETU1/E1 transcript
Pre-hybridization 63C 60 min in 1x SSPE (150 mM NaCl,10 mM NaH2PO4, 1mM EDTA; PH7), 0.2xBP (1XBP is 2% bovine serum albumin, 2% polyvinylpyrolidone) plus 1%SDS.
Hybridization 62C 180 min in 1x SSPE-0.2XBP-1%SDS
Post-Hybridization (Room temp 5min in 0.005 SSPE-0.05%SDS)*3
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.