A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: CW0003Publication date: 07/99
PMID: 10405392GI: 330756 Taxonomy ID: 10320
Virus Name: Bovine herpesvirus 1, BHV1Product size (PCR): N/A bp
MgCl2: 1.5 mMdNTPs: mMType: PCR
Temp (PCR cycle):(96C 1 min>65C 45sec>72C 45sec)*10>(96C 1 min>54C 45sec>72C 45sec)*15>(96C 1 min>60C 45sec>72C 45sec)*10>72C 10 min
Buffer: 20 mM Tris-HCl (pH8.4), 50 mM KCl
Polymerase: 0.5U/microL Taq polyCycler: Biometra Trio, Gottingen, Germany
Note: PCR reagent boiled for 3 min and added Polyerase @ 80C.
A pair of PCR primers were used for each amplification
Forward(gB-1) primer
Oligo type: PCRDegeneracy: 1
Target: 883-902Tm: 76.1 C at salt 1000.0mMLength:
Sequence: TACGACTCGTTCGCGCTCTC
(0 other experimental conditions)
Note: Coupled with gB-2 Primer
Manufactured from BHV1 GI: 330756
Reverse(gB-2) primer
Oligo type: PCRDegeneracy: 1
Target: 1341-1360Tm: 78.2 C at salt 1000.0mMLength:
Sequence: GGTACGTCTCCAAGCTGCCC
(0 other experimental conditions)
Note: Coupled with gB-1 Primer
Manufactured from BHV1 GI: 330756
Forward(gBN-1) primer
Oligo type: PCRDegeneracy: 1
Target: 899-918Tm: 74.1 C at salt 1000.0mMLength:
Sequence: TCTCGACCGGGGACATTATC
(0 other experimental conditions)
Note: Coupled with gBN-2 Primer
Manufactured from BHV1 GI: 330756
Reverse(gBN-2) primer
Oligo type: PCRDegeneracy: 1
Target: 1264-1283Tm: 76.1 C at salt 1000.0mMLength:
Sequence: GCCTCTTCGATCACGCAGTC
(0 other experimental conditions)
Note: Coupled with gBN-1 Primer
Manufactured from BHV1 GI: 330756
Forward(gC-1) primer
Oligo type: PCRDegeneracy: 1
Target: 563-581Tm: 78.5 C at salt 1000.0mMLength:
Sequence: AGGAGCGCAAGTGGATGCTCTG
(0 other experimental conditions)
Note: Coupled with gC-2 Primer
Manufactured from BHV1 GI: 330754
Reverse(gC-2) primer
Oligo type: PCRDegeneracy: 1
Target: 1068-1087Tm: 80.3 C at salt 1000.0mMLength:
Sequence: GTAGCCGTTGCGGAACCAGTGC
(0 other experimental conditions)
Note: Coupled with gC-1 Primer
Manufactured from BHV1 GI: 330754
Forward(gE-1) primer
Oligo type: PCRDegeneracy: 1
Target: 501-520Tm: 76.1 C at salt 1000.0mMLength:
Sequence: GCTTCGGTCGACACGGTCTT
(0 other experimental conditions)
Note: Coupled with gE-2 Primer
Manufactured from BHV1 GI: 459193
Reverse(gE-2) primer
Oligo type: PCRDegeneracy: 1
Target: 746-765Tm: 76.1 C at salt 1000.0mMLength:
Sequence: CTTTGTCGCCCGTTGAGTCG
(0 other experimental conditions)
Note: Coupled with gE-1 Primer
Manufactured from BHV1 GI: 459193
Forward(gEN-1) primer
Oligo type: PCRDegeneracy: 1
Target: 536-554Tm: 78 C at salt 1000.0mMLength:
Sequence: CGCGCCCGTCTTTCTCCCA
(0 other experimental conditions)
Note: Coupled with gEN-2 Primer
Manufactured from BHV1 GI: 459193
Reverse(gEN-2) primer
Oligo type: PCRDegeneracy: 1
Target: 655-674Tm: 75.8 C at salt 1000.0mMLength:
Sequence: CACGTCGGTGAAGCACTCG
(0 other experimental conditions)
Note: Coupled with gEN-1 Primer
Manufactured from BHV1 GI: 459193
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.