A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BM1829Publication date: 06/02
PMID: 12051502GI: 6456593 Taxonomy ID: 12110
Virus Name: Foot-and-mouth disease virus, FMDVProduct size (PCR):
bp
MgCl2: N/A mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):60C 10min>(95C 2sec>60C 30sec)*45
Buffer: 5mM Mn(OAc)2, 1x EZ-RT-PCR buffer (Perkin Elmer), 0.2mM dUTP, 100ng/microL BSA, 500mM trehalose
Polymerase: 0.0001U/microL rTth DNA polyCycler: real-time SmartCycler (Cepheid Inc; Sunnyvale, CA)
Note: Uinversal PCR. Primers amplify all FMDV serotypes.

Single-step RT-PCR is performed in 25microL total volume containing 2.5microL genomic template, 0.3mM each primer, and 0.3mM probe.

Article does not mention addition of MgCl2 in reaction.
dTTP is not included in dNTP mixture.
Article gives polymerase concentration as 0.1U/mL and oligonucleotide concentrations at 0.3mM.
Forward(PM00247) primer
Oligo type: Degeneracy: 1
Target: 6769-6790Tm: 71 C at salt 1000.0mMLength:
Sequence: ACTGGGTTTTACAAACCTGTGA
(0 other experimental conditions)
Note:
Reverse(PM00249) primer
Oligo type: Degeneracy: 1
Target: 6875-6859Tm: 58 CLength:
Sequence: GCGAGTCCTGCCACGGA
(0 other experimental conditions)
Note:
Forward(PM00250) primer
Oligo type: Degeneracy: 1
Target: 6820-6839Tm: 78.2 C at salt 1000.0mMLength:
Sequence: TCCTTTGCACGCCGTGGGAC
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.