A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BM1811Publication date: 12/01
PMID: 11878878GI: 2465191 Taxonomy ID: 11099
Virus Name: pestivirus type 1Product size (PCR):
bp
MgCl2: N/A mMdNTPs: mMType: RT-Nested PCR 2
RT-Nested PCR 1(5) RT-Nested PCR 1(4) RT-Nested PCR 1(3)
Temp (PCR cycle):95C 2min>(95C 40sec>56C 40sec>72C 50sec)*30>72C 5min
Buffer: Taq polymerase buffer
Polymerase: Taq poly (QBiogene)Cycler:
Note: For RT and primary PCRs, [see BM1806], [see BM1807], [see BM1808], [see BM1809], and [see BM1810].

PCR is performed using 2microL primary PCR product and 32.5pmol each primer.
Article does not mention amount of PCR reagents used and total PCR volume.
Forward(Ol-LSIV) primer
Oligo type: Degeneracy: 1
Target: 1849-1878Tm: 83.4 C at salt 1000.0mMLength:
Sequence: GGGGGATCCTAAGGCAGCATCCTACCAAAA
(0 other experimental conditions)
Note: Multiple mismatches.
Reverse(Ol-Jas/Jf) primer
Oligo type: Degeneracy: 1
Target: 2175-2155Tm: 72.5 C at salt 1000.0mMLength:
Sequence: CTGTGATCTTCTTACACACGG
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.