A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BM1810Publication date: 12/01
PMID: 11878878GI: 2465191 Taxonomy ID: 11099
Virus Name: pestivirus type 1Product size (PCR):
bp
MgCl2: N/A mMdNTPs: mMType: RT-Nested PCR 1(5)
RT-Nested PCR 1(4)
Temp (PCR cycle):50C 30min>95C 15min>(94C 30sec>53C 30sec>72C 60sec)*39
Buffer: N/A
Polymerase: N/ACycler:
Note: RT-PCR is performed using 2microg purified RNA and the One-Step RT-PCR kit (Qiagen) as recommended by the supplier.

For secondary PCR, [see BM1811].
For other primary PCRs, [see BM1806], [see BM1807], [see BM1808], and [see BM1809].
Forward(Ol-JasIns2) primer
Oligo type: Degeneracy: 1
Target: 1836-1852Tm: 50 CLength:
Sequence: GTAGAAGATGTCCGACT
(2 other experimental conditions)
Note:
Reverse(Ol-B22.1R) primer
Oligo type: Degeneracy: 1
Target: 2198-2178Tm: 70.5 C at salt 1000.0mMLength:
Sequence: GTTGACATGGCATTTTTCGTG
(4 other experimental conditions)
Note: Mismatches at positions 2198 and 2192.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.