A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BM1809Publication date: 12/01
PMID: 11878878GI: 9836967 Taxonomy ID: 11099
Virus Name: pestivirus type 1Product size (PCR):
bp
MgCl2: N/A mMdNTPs: mMType: RT-Nested PCR 1(4)
RT-Nested PCR 1(3)
Temp (PCR cycle):(94C 30sec>52C 30sec>68C 90sec)*9>(94C 30sec>52C 30sec>68C 45sec[+5sec/cyc])*25>68C 7min
Buffer: N/A
Polymerase: N/ACycler:
Note: RT-PCR is performed using the Titan One Tube RT-PCR kit (Roche Molecular Biochemicals) as recommended by the supplier.

For secondary PCR, [see BM1811].
For other primary PCRs, [see BM1806], [see BM1807], [see BM1808], and [see BM1810].
Forward(Ol-B19II) primer
Oligo type: Degeneracy: 1
Target: 4534-4553Tm: 67.9 C at salt 1000.0mMLength:
Sequence: CAAATGGCAGATGGTGTATA
(1 other experimental conditions)
Note:
Reverse(Ol-B22.1R) primer
Oligo type: Degeneracy: 1
Target: 5227-5207Tm: 70.5 C at salt 1000.0mMLength:
Sequence: GTTGACATGGCATTTTTCGTG
(4 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.