A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BM1808Publication date: 12/01
PMID: 11878878GI: 2465191 Taxonomy ID: 11099
Virus Name: pestivirus type 1Product size (PCR):
bp
MgCl2: N/A mMdNTPs: mMType: RT-Nested PCR 1(3)
RT-Nested PCR 1(2)
Temp (PCR cycle):(94C 30sec>52C 30sec>68C 90sec)*9>(94C 30sec>52C 30sec>68C 45sec[+5sec/cyc])*25>68C 7min
Buffer: N/A
Polymerase: N/ACycler:
Note: Primer sets Ol-B32II/Ol-JasIns1, Ol-JasIns2/Ol-B22.1R, and Ol-BVDV32/Ol-JasIns1 are used in separate reactions.
Primer set Ol-BVDV32/Ol-JasIns1 detected pestiviruses with internal deletions most effectively.

RT-PCR is performed using the Titan One Tube RT-PCR kit (Roche Molecular Biochemicals) as recommended by the supplier.

For secondary PCR, [see BM1811].
For other primary PCRs, [see BM1806], [see BM1807], [see BM1809], and [see BM1810].
Forward(Ol-BVDV32) primer
Oligo type: Degeneracy: 1
Target: 347-371Tm: 75.5 C at salt 1000.0mMLength:
Sequence: AAATCTCTGCTGTACATGGCACATG
(1 other experimental conditions)
Note: Specific to [GI:1518835].
Reverse(Ol-JasIns1) primer
Oligo type: Degeneracy: 1
Target: 1882-1865Tm: 54 CLength:
Sequence: GGGATTTTGGTAGGATGC
(1 other experimental conditions)
Note:
Forward(Ol-B32II) primer
Oligo type: Degeneracy: 1
Target: 1163-1183Tm: 78.3 C at salt 1000.0mMLength:
Sequence: CCAAGTCCCTGTGCTGTTCCC
(1 other experimental conditions)
Note:
Forward(Ol-JasIns2) primer
Oligo type: Degeneracy: 1
Target: 1836-1852Tm: 50 CLength:
Sequence: GTAGAAGATGTCCGACT
(2 other experimental conditions)
Note:
Reverse(Ol-B22.1R) primer
Oligo type: Degeneracy: 1
Target: 2198-2178Tm: 70.5 C at salt 1000.0mMLength:
Sequence: GTTGACATGGCATTTTTCGTG
(4 other experimental conditions)
Note: Mismatches at positions 2198 and 2192.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.