A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BM1807Publication date: 12/01
PMID: 11878878GI: 9836967 Taxonomy ID: 11099
Virus Name: pestivirus type 1Product size (PCR):
bp
MgCl2: 2.5 mMdNTPs: mMType: RT-Nested PCR 1(2)
RT-Nested PCR 1(1)
Temp (PCR cycle):(94C 30sec>55C 30sec>72C 60sec)*35>68C 10min
Buffer: 25mM Tris-HCl (pH 8.3), 50mM KCl, 0.1% Triton X-100, 0.02% BSA
Polymerase: 0.1U/microL Taq poly (QBiogene)Cycler:
Note: 11.5microL RNA-primer mixture containing 173.9ng/microL RNA and 2.61microM reverse primer are incubated 94C 3min>8C 10min.
RT is performed in 20microL total volume containing 11.5microL RNA-primer mixture, 50mM Tris-HCl (pH 8.3), 73mM KCl, 3.0mM MgCl2, 10mM DTT, 0.5mM each dNTP, 0.75U/microL RNAguard (Pharmacia), and 2.5U/microL Superscript RTase (Life Technologies BRL).
RT temperature: 37C 45min

PCR is performed in 50microL containing all 20microL cDNA.
Article does not mention concentration of forward primer used in PCR.

For secondary PCR, [see BM1811].
For other primary PCRs, [see BM1806], [see BM1808], [see BM1809], and [see BM1810].
Forward(Ol-B19II) primer
Oligo type: Degeneracy: 1
Target: 4534-4553Tm: 67.9 C at salt 1000.0mMLength:
Sequence: CAAATGGCAGATGGTGTATA
(1 other experimental conditions)
Note:
Reverse(Ol-B22.1R) primer
Oligo type: Degeneracy: 1
Target: 5227-5207Tm: 70.5 C at salt 1000.0mMLength:
Sequence: GTTGACATGGCATTTTTCGTG
(4 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.