A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BM1303Publication date: 09/94
PMID: 7802385GI: 221806 Taxonomy ID: 10320
Virus Name: Bovine herpesvirus 1Product size (PCR):
bp
MgCl2: 0.3 mMdNTPs: mMType: PCR
Temp (PCR cycle):95C 1min>(95C 1min>61C 1min>72C 1min)*35>72C 4min
Buffer: 1x Taq poly buffer, 6% glycerol
Polymerase: 0.025U/microL Taq DNA polyCycler: DNA thermal cycler (Perkin-Elmer)
Note: PCR is performed by first creating two layers of reagents using the following method:
20microL containing 0.4microM each primer, 0.2mM dNTPs, 1.5mM MgCl2, 1.25x Taq poly buffer, and 1 AmpliWax PCR Gem (Perkin-Elmer Ltd.) are sealed by heating 80C 10min>25C 1min.
80microL containing 1.25x Taq poly buffer, 10% glycerol, 20microL heat-denatured sample, and 0.042U/microL polymerase are added above the sealed wax layer.

The wax melts during the 95C 1min to create a total PCR volume of 100microL.
Forward(IBR TK1) primer
Oligo type: Degeneracy: 1
Target: 973-994Tm: 74.7 C at salt 1000.0mMLength:
Sequence: AGACCCCAGTTGTGATGAATGC
(2 other experimental conditions)
Note:
Reverse(IBR TK2) primer
Oligo type: Degeneracy: 1
Target: 1155-1136Tm: 76.1 C at salt 1000.0mMLength:
Sequence: ACACGTCCAGCACGAACACC
(2 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.