A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BM0993Publication date: 11/00
PMID: 11110380GI: 330689 Taxonomy ID: 10385
Virus Name: Bovine herpesvirus 4, BHV-4Product size (PCR): 153 bp
MgCl2: 2.0 mMdNTPs: mMType: Seminested PCR 1
Temp (PCR cycle):94C 1min>(94C 1min>59C 2min>72C 3min)*35
Buffer: 50mM KCl, 10mM Tris-HCl (pH 8.3)
Polymerase: 0.02U/microL Taq DNA poly (Perkin Elmer Corp.)Cycler:
Note: Total PCR volume is 25microL containing 0.5microM each primer.

For secondary PCR, [see BM0994].
Forward(P1) primer
Oligo type: PCRDegeneracy: 1
Target: 24-47Tm: 68.5 C at salt 1000.0mMLength:
Sequence: CATGACACACTATTTTAAGTACTA
(1 other experimental conditions)
Note: Mismatch at position 43.
Reverse(P2) primer
Oligo type: Degeneracy: 1
Target: 176-147Tm: 75.2 C at salt 1000.0mMLength:
Sequence: ATCTTTCTTTCAGTCTCACTAAGTACACTA
(1 other experimental conditions)
Note: Multiple mismatches between position 157 and 147.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.