A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BM0559Publication date: 2000
PMID: 11145272GI: 15282441 Taxonomy ID: 155905
Virus Name: pestivirus Giraffe-1Product size (PCR):
bp
MgCl2: 1.5 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):(94C 30sec>55C 120sec>72C 120sec)*30
Buffer: 10.6mM Tris-HCl, 98mM KCl, 500microg/mL BSA, 0.1% sodium chlorate, 0.1% Triton X-100, 6microM EDTA, 3% glycerol
Polymerase: 0.025U/microL Tth DNA polyCycler:
Note: Total RT volume is 40microL containing 8microL RNA, 1x RT buffer, 10mM DTT, 0.625U/microL MMLV RTase (Gibco-BRL), 0.2mM each dNTP, 5.5U/mL ribonuclease inhibitor (Takara Shuzo Co, Ltd.), and 0.25microM primer R1.
RT temperature: 36C 90min

Total PCR volume is 50microL containing 6microL cDNA and 0.2microM each primer.
Reverse(R1) primer
Oligo type: Degeneracy: 1
Target: 389-370Tm: 72 C at salt 1000.0mMLength:
Sequence: ACTCCATGTGCCATGTACAG
(5 other experimental conditions)
Note:
Forward(F1) primer
Oligo type: Degeneracy: 4
Target: 102-121Tm: Max Tm 74.1 C Min Tm 72 C at salt 1000.0mMLength:
Sequence: ATGCCC(A/T)(C/T)AGTAGGACTAGC
(4 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.