A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BM0546Publication date: 1993
PMID: 8385843GI: 61076 Taxonomy ID: 12115
Virus Name: Foot-and-mouth disease virus (strain A24 Cruzeiro); Foot-and-mouth disease virus Asia 1; foot-and-mouth disease virus C1; Foot-and-mouth disease virus O; Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3Product size (PCR):
bp
MgCl2: 1.5 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):95C 5min>(94C 1min>50C 1min>70C 2min)*30>70C 7min
Buffer: 66mM Tris-HCl (pH 8.3), 17mM (NH4)2SO4, 850microg/mL BSA, 10mM 2-mercaptoethanol
Polymerase: 1.25U Taq poly (AmpliTaq, Perkin-Elmer Cetus)Cycler: thermal cycler (Perkin-Elmer Cetus)
Note: Universal PCR.
Primer set P1/P2 amplifies all 7 serotypes.
Primer set TD1/P2 amplifies A24, O, and Asia 1.
Primer set TP1/TD2 amplifies A24 and O.

FMDV A24 Cruzeiro [Taxonomy:12115]
FMDV Asia 1 [Taxonomy:110195]
FMDV C1 [Taxonomy:12121]
FMDV O [Taxonomy:12118]
FMDV SAT 1 [Taxonomy:12122]
FMDV SAT 2 [Taxonomy:35292]
FMDV SAT 3 [Taxonomy:12123]

Total RT volume is 50microL containing 5microg total RNA, 50mM Tris-HCl, 6mM MgCl2, 40mM KCl, 10mM DTT, 1mM dNTPs (Boehringer), 0.2U/microL RNasin (RNase inhibitor, human placenta, Boehringer), 0.2U/microL MMLV RTase (Boehringer), and 2microM primer P2.
RT temperature: Room temperature 10min>37C 30-60min>100C 5min.
Article does not specificy which RT time gives better results.

Article does not mention total PCR volume.
5-10microL cDNA is used to 15-20microL PCR buffer and 0.1microM each primers (P1 and P2, TD1 and P2, or TD1 and TD2).
Forward(P1) primer
Oligo type: Degeneracy: 1
Target: 3363-3382Tm: 74.1 C at salt 1000.0mMLength:
Sequence: CCTACCTCCTTCAACTACGC
(0 other experimental conditions)
Note:
Reverse(P2) primer
Oligo type: Degeneracy: 1
Target: 3378-3358Tm: 80.3 C at salt 1000.0mMLength:
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note:
Forward(TD1) primer
Oligo type: Degeneracy: 1
Target: 3246-3266Tm: 84.2 C at salt 1000.0mMLength:
Sequence: GCGCCCCACCGCGTGTTGGCA
(0 other experimental conditions)
Note:
Reverse(TD2) primer
Oligo type: Degeneracy: 1
Target: 3382-3363Tm: 74.1 C at salt 1000.0mMLength:
Sequence: CCGTAGTTGAAGGAGGTAGG
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.