A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BM0537Publication date: 10/01
PMID: 11708680GI: 9629818 Taxonomy ID: 10320
Virus Name: Bovine herpesvirus 1, BHV-1; Bovine herpesvirus 5, BHV-5Product size (PCR):
bp
MgCl2: 1.5 mMdNTPs: mMType: multiplex PCR
Temp (PCR cycle):95C 1min>(95C 1min>61.4C 1min>72C 1min)*35>72C 5min
Buffer: 1x Taq polymerase buffer, 5microL glycerol
Polymerase: 0.05U/microL Taq polyCycler:
Note: Multiplex PCR
Primer set TK1/TK2 [GI:9629818] is specific to BHV-1 [Taxonomy:10320].
Primer set GD1/GD2 [GI:641976] is specific to BHV-5 [Taxonomy:35244].

5microL DNA, 2.78ng/microL each primer, and water in a total volume of 36microL water is incubated at 99C for 10min.
The temperature is lowered to 88C and other reagents are added to a total PCR volume of 50microL.
Article does not mention concentration of glycerol used in PCR.
Forward(TK1) primer
Oligo type: Degeneracy: 1
Target: 63994-64015Tm: 74.7 C at salt 1000.0mMLength:
Sequence: AGACCCCAGTTGTGATGAATGC
(2 other experimental conditions)
Note:
Reverse(TK2) primer
Oligo type: Degeneracy: 1
Target: 64178-64159Tm: 76.1 C at salt 1000.0mMLength:
Sequence: ACACGTCCAGCACGAACACC
(2 other experimental conditions)
Note:
Forward(GD1) primer
Oligo type: Degeneracy: 1
Target: 29-47Tm: 78 C at salt 1000.0mMLength:
Sequence: GCCCGCAGTTTCCCCTACC
(0 other experimental conditions)
Note:
Reverse(GD2) primer
Oligo type: Degeneracy: 1
Target: 592-574Tm: 73.7 C at salt 1000.0mMLength:
Sequence: CGCACCCGCTCTCAATCTT
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.