A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BM0536Publication date: 03/98
PMID: 9629589GI: 12018088 Taxonomy ID: 12111
Virus Name: Foot-and-mouth disease virus A; Foot-and-mouth disease virus C; Foot-and-mouth disease virus O; Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3Product size (PCR):
bp
MgCl2: N/A mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):96C 60sec>(96C 12sec>49C 20sec>70C 40sec)*30
Buffer: 1x buffer (DynaZyme)
Polymerase: 0.02U/microL Taq poly (DynaZyme)Cycler:
Note: Each primer set is used in a separate PCR.
Primer set P1/W-US amplifies all SAT strains but no other strains.
A universal PCR using primer set P1/VP1Ub amplifies the following viruses:
FMDV A [Taxonomy:12111]
FMDV C [Taxonomy:12116]
FMDV O [Taxonomy:12118]
FMDV SAT 1 [Taxonomy:12122]
FMDV SAT 2 [Taxonomy:35292]
FMDV SAT 3 [Taxonomy:12123]

Article does not mention RT conditions and reagents, except that primer 2B is used for RT.

Total PCR volume is 25microL containing 1-2microL cDNA and 0.25microM each primer.
Article does not mention the addition of MgCl2 in PCR.
Reverse(2B) primer
Oligo type: Degeneracy: 1
Target: 3994-3975Tm: 74.1 C at salt 1000.0mMLength:
Sequence: GACATGTCCTCCTGCATCTG
(3 other experimental conditions)
Note: Used in RT.
Reverse(P1) primer
Oligo type: Degeneracy: 1
Target: 3923-3903Tm: 80.3 C at salt 1000.0mMLength:
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Mismatch at position 3914.
Forward(W-US) primer
Oligo type: Degeneracy: 1
Target: 3436-3455Tm: 67.9 C at salt 1000.0mMLength:
Sequence: CCACGTATTACTTTTGTGAC
(0 other experimental conditions)
Note: Mismatches at positions 3643 and 3651.
Forward(VP1Ub) primer
Oligo type: Degeneracy: 2
Target: 3436-3460Tm: Max Tm 78.8 C Min Tm 77.2 C at salt 1000.0mMLength:
Sequence: CCACGTACTACTT(T/C)TCTGACCTGGA
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.