A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BM0535Publication date: 05/99
PMID: 10328832GI: 15320904 Taxonomy ID: 12115
Virus Name: Foot-and-mouth disease virus (strain A24 Cruzeiro)Product size (PCR):
bp
MgCl2: 4.6 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):(95C 10sec>60C 10sec)*5>(95C 0sec>60C 0sec>72C 5sec)*25
Buffer: 0.8x Stoffel buffer (Perkin-Elmer)
Polymerase: 0.5microL Stoffel fragment of Taq DNA poly (Perkin-Elmer)Cycler: Perkin-Elmer 9600
Note: Total RT volume is 10microL containing 50mM Tris-HCl (pH 8.3), 75mM KCl, 3mM MgCl2, 10mM DTT, 1mM dNTPs, 0.5microM random hexamers (Gibco), 0.1U/microL RNAsin (Promega), 2U/microL superscript II RTase, and 5microL RNA.
RT temperature: 41C 45min>95C 8min>10C 3min

Total PCR volume is 50microL containing 0.375microM each primer and all 10microL cDNA.
Article does not mention the DNA poly concentration and the addition of dNTPs in PCR.
Reverse(PJ00341) primer
Oligo type: Degeneracy: 1
Target: 3759-3740Tm: 74.1 C at salt 1000.0mMLength:
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:
Forward(PJ00342) primer
Oligo type: Degeneracy: 1
Target: 3629-3648Tm: 74.1 C at salt 1000.0mMLength:
Sequence: CAGATGCAGGAGGACATGTC
(3 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.