A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BM0499Publication date: 06/99
PMID: 10403677GI: 61076 Taxonomy ID: 12118
Virus Name: Foot-and-mouth disease virus O; Foot-and-mouth disease virus (strain A24 Cruzeiro); Foot-and-mouth disease virus C; Foot-and-mouth disease virus Asia 1; Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3Product size (PCR):
bp
MgCl2: 1.5 mMdNTPs: mMType: RT-nested PCR 2
RT-nested PCR 1
Temp (PCR cycle):94C 60sec>(92C 30sec>60C 30sec>75C 90sec)*30>75C 5min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.02U/microL Taq polyCycler: Trio-Thermoblock (Biometra)
Note: Universal PCR. Primers amplify the following viruses:
FMDV O [Taxonomy:12118]
Strain A24 Cruzeiro [Taxonomy:12115]
FMDV C [Taxonomy:12116]
Asia 1 [Taxonomy:110195]
SAT 1 [Taxonomy:12122]
SAT 2 [Taxonomy:35292]
SAT 3 [Taxonomy:12123]

For RT and primary PCR, [see BM0498].

Total secondary PCR volume is 50microL containing 1microL primary PCR product and 2mM each primers 3C2 and 3B3.
Reverse(3C2) primer
Oligo type: Degeneracy: 1
Target: 6205-6186Tm: 74.1 C at salt 1000.0mMLength:
Sequence: GAGTGAGTGCCGACGATGAA
(0 other experimental conditions)
Note:
Forward(3B3) primer
Oligo type: Degeneracy: 1
Target: 5621-5640Tm: 67.9 C at salt 1000.0mMLength:
Sequence: CGCTTTGAAAGTGAAAGCTA
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.