A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BM0492Publication date: Fall/91
PMID: 1666635GI: 210476 Taxonomy ID: 73482
Virus Name: Foot-and-mouth disease virus (strain O1); foot-and-mouth disease virus C1; Foot-and-mouth disease virus (strain A12); Foot-and-mouth disease virus (strain A5); Foot-and-mouth disease virus Asia 1Product size (PCR):
bp
MgCl2:
mM
dNTPs: mMType: Southern blot hybridization
Temp (PCR cycle):42C 12hr
Buffer: 5x SSC, 0.04% SDS, 0.1% N-lauroylsarcosine, 2% modified milk protein (Boehringer-Manheim)
Polymerase:
Cycler:
Note: For PCR product used, [see BM0491].

PCR product on nylon hybridization membranes (MSI, Westborough, MA) is prehybridized in buffer at 42C for 60min.
Membranes are hybridized in the same buffer containing 10pmol 3'-end-labeled digoxigenin-dUTP probe 1P.

For other PCR in this article, [see BM0490].
Forward(1P) primer
Oligo type: Degeneracy: 1
Target: 579-600Tm: 80.3 C at salt 1000.0mMLength:
Sequence: TTCGAGAACGGCACGGTCGGAC
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.