A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BM0490Publication date: Fall/91
PMID: 1666635GI: 210476 Taxonomy ID: 73482
Virus Name: Foot-and-mouth disease virus (strain O1); foot-and-mouth disease virus C1; Foot-and-mouth disease virus (strain A12); Foot-and-mouth disease virus (strain A5); Foot-and-mouth disease virus Asia 1Product size (PCR): 454 bp
MgCl2: 1.5 mMdNTPs: mMType: RT-PCR 1
Temp (PCR cycle):(95C 30sec>55C 30sec>72C 30sec)*30
Buffer: 1x PCR buffer
Polymerase: 0.005U/microL Taq DNA poly (Perkin-Elmer Cetus)Cycler:
Note: Primers amplify the following viruses:
Strain O1 [Taxonomy:73482].
Strain C1 [Taxonomy:12121].
Strain A12 [Taxonomy:12114].
Strain A5 [Taxonomy:12113].
Strain Asia 1 [Taxonomy:110195].

RT is performed in a total volume of 20microL containing 50mM KCl, 10mM Tris-HCl (pH 8.3), 1.5mM MgCl2, 0.001% (w/v) gelatin, 1mM each dNTP, 0.05U/microL RNAsin (Promega), 5microM random hexamers (Gibco), 1microL viral RNA sample, and 10U/microL MMLV RTase (Gibco).
RT temperature: 42C 60min>95C 10min

Total PCR volume is 100microL containing all 20microL cDNA and 0.3microM each primer.
Article does not mention the addition of dNTPs in PCR.

This PCR product is used for secondary amplification using the same primers, [see BM0491].
For hybridization in this article, [see BM0492].
Forward(1US) primer
Oligo type: Degeneracy: 1
Target: 385-404Tm: 76.1 C at salt 1000.0mMLength:
Sequence: AGGACAAAGCGCTGTTCCGC
(0 other experimental conditions)
Note:
Reverse(1DS) primer
Oligo type: Degeneracy: 1
Target: 838-819Tm: 78.2 C at salt 1000.0mMLength:
Sequence: TCAGGGTTGCAACCGACCGC
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.