A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BM0489Publication date: 06/94
PMID: 8079512GI: 10445391 Taxonomy ID: 12120
Virus Name: Foot-and-mouth disease virus (strain C1-Santa Pau)Product size (PCR):
bp
MgCl2: 1.6 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):(94C 1min>55C 1min>72C 2min)*30>72C 8min
Buffer: 10mM Tris-HCl (pH 8.3), 4.0mM KCl
Polymerase: 0.025U/microL Taq poly (Promega)Cycler: DNA thermal cycler (Perkin Elmer)
Note: Total RT volume is 20microL containing 50mM Tris-HCl (pH 8.0), 8mM MgCl2, 10mM DTT, 50mM KCl, 0.2mM dNTPs, 0.375U/microL AMV RTase, 1U/microL RNasin ribonuclease inhibitor (Promega), and RNA.
Article does not mention concentration of primer PJ00326 used in RT.
RT temperature: 42C 90min.

Total PCR volume is 100microL containing all 20microL cDNA and primer PJ00327.
Article does not mention concentration of primer or the addition of dNTPs in PCR.

For other PCR in this article, [see BM0488].
Reverse(PJ00326) primer
Oligo type: Degeneracy: 1
Target: 3848-3829Tm: 72 C at salt 1000.0mMLength:
Sequence: AGCAGGTCAAAGTTCAGCAG
(0 other experimental conditions)
Note:
Forward(PJ00327) primer
Oligo type: Degeneracy: 1
Target: 3194-3213Tm: 70 C at salt 1000.0mMLength:
Sequence: ACGCTAGACAACAAACTACG
(0 other experimental conditions)
Note: Mismatch at position 3202.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.