A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BM0484Publication date: 03/92
PMID: 1313822GI: 61076 Taxonomy ID: 73482
Virus Name: Foot-and-mouth disease virus (strain O1); Foot-and-mouth disease virus (strain A12)Product size (PCR):
bp
MgCl2: 1.5 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):(93C 30sec>55C 30sec>72C 60sec)*35>72C 9min
Buffer: 10mM Tris-HCl (pH 8.3) 50mM KCl
Polymerase: 0.08U/microL Taq DNA poly (IBI)Cycler: programmable thermal controller (MJ Research Inc.)
Note: Primers amplify following viruses:
Strain O1 [Taxonomy:73482].
Strain A12 [Taxonomy:12114].

Total RT volume is 20microL containing RNA, 20U/microL RNasin (Promega), 0.5mM dNTPs (Pharmacia), 0.815U/microL AMV RTase (Life Science Inc.), 1x buffer (Life Science Inc.) and 50microM Oligo 7.
RT temperature: 42C 1hr.

Total PCR volume is 50microL containing 1microL cDNA and 20microM each primers.
Article does not mention final concentration of dNTPs for PCR.

For other PCRs in this article, [see BM0482] and [see BM0483].
Reverse(Oligo 7) primer
Oligo type: Degeneracy: 1
Target: 7676-7656Tm: 70.5 C at salt 1000.0mMLength:
Sequence: GTAAAGTGATCTGTAGCTTGG
(0 other experimental conditions)
Note:
Forward(Oligo 9) primer
Oligo type: Degeneracy: 1
Target: 6699-6719Tm: 78.3 C at salt 1000.0mMLength:
Sequence: TTCGAGAACGGCACGGTCGGA
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.