A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BM0482Publication date: 03/92
PMID: 1313822GI: 61076 Taxonomy ID: 73482
Virus Name: Foot-and-mouth disease virus (strain O1)Product size (PCR):
bp
MgCl2:
mM
dNTPs: mMType: RT-PCR
Temp (PCR cycle):(93C 30sec>55C 30sec>72C 60sec)*35>72C 9min
Buffer: 40mM KCl
Polymerase: 0.08U/microL Taq DNA poly (IBI)Cycler: HYBAID thermal reactor
Note: Total RT volume is 20microL containing RNA, 20U/microL RNasin (Promega), 0.5mM dNTPs (Pharmacia), 0.815U/microL AMV RTase (Life Science Inc.), 1x buffer (Life Science Inc.).
Article does not mention concentration of Oligo 2 used for RT.
RT temperature: 42C 1hr.

Total PCR volume is 50microL containing 10microL cDNA and 2microM each primers.
Article does not mention the addition of dNTPs, MgCl2, and other reagents for PCR.

For other PCRs in this article, [see BM0483] and [see BM0484].
Reverse(Oligo 2) primer
Oligo type: Degeneracy: 1
Target: 3603-3585Tm: 71.5 C at salt 1000.0mMLength:
Sequence: AGTTCGACCTAACGTCGGA
(1 other experimental conditions)
Note:
Forward(Oligo 1) primer
Oligo type: Degeneracy: 1
Target: 3196-3215Tm: 70 C at salt 1000.0mMLength:
Sequence: CAACTGCTTACCACAAAAGG
(0 other experimental conditions)
Note: Multiple mismatches.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.