A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BM0471Publication date: 10/01
PMID: 11524161GI: 323205 Taxonomy ID: 11100
Virus Name: bovine viral diarrhea virus (isolate NADL); bovine viral diarrhea virus strain Oregon C24V; pestivirus type 1 (isolate 890) Product size (PCR):
bp
MgCl2: 4.0 mMdNTPs: mMType: Real Time RT-PCR
Temp (PCR cycle):48C 30min>95C 10min>(95C 15sec>60C 60sec)*45
Buffer: TaqMan universal 1x buffer
Polymerase: 0.025U/microL AmpliTaq Gold DNA polyCycler:
Note: Primer set PD00257/PD00256, derived from [GI:323205], amplifies the following viruses:
Isolate NADL [Taxonomy:11100]
Strain Oregon C24V [Taxonomy:82470]
Isolate 890 [Taxonomy:11099]

Probe PD00258 is specific to Type I BVDV [GI:323205].
Probe PD00259 is specific to Type II BVDV [GI:902376].

One-tube assays are carried out in a 96-well falt-bottomed microtiter plate (Perkin-Elmer).
Total volume in each well is 50microL containing 0.2microM each primer PD00257 and PD00256, 0.1microM each probe PD00258 and PD00259, 0.5U/microL MultiScribe RTase, 0.4U/microL RNAse inhibitor, and 2.5microL RNA.

For other PCR from this article, [see BM0472].
Forward(PD00258) primer
Oligo type: Degeneracy: 1
Target: 145-171Tm: 79 C at salt 1000.0mMLength:
Sequence: AACAGTGGTGAGTTCGTTGGATGGCTT
(0 other experimental conditions)
Note:
Forward(PD00259) primer
Oligo type: Degeneracy: 1
Target: 147-172Tm: 80.5 C at salt 1000.0mMLength:
Sequence: TAGCAGTGAGTCCATTGGATGGCCGA
(0 other experimental conditions)
Note:
Forward(PD00257) primer
Oligo type: Degeneracy: 1
Target: 103-123Tm: 74.4 C at salt 1000.0mMLength:
Sequence: TAGCCATGCCCTTAGTAGGAC
(0 other experimental conditions)
Note:
Reverse(PD00256) primer
Oligo type: Degeneracy: 1
Target: 196-176Tm: 76.4 C at salt 1000.0mMLength:
Sequence: GACGACTACCCTGTACTCAGG
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.