A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BM0341Publication date: 06/98
PMID: 9694331GI: 61076 Taxonomy ID: 73481
Virus Name: Foot-and-mouth disease virus (strain A22/550 AZERBAIJAN 65); Foot-and-mouth disease virus (strain A24 Cruzeiro); Foot-and-mouth disease virus Asia 1; foot-and-mouth disease virus C1; Foot-and-mouth disease virus SAT 2Product size (PCR):
bp
MgCl2:
mM
dNTPs: mMType: RT-PCR
Temp (PCR cycle):(93C 30sec>55C 2min>72C 5min)*30>72C 10min
Buffer:
Polymerase: 0.025U/microL Taq poly (Boehringer)Cycler: PTC 100
Note: Strain A22/550 AZERBAIJAN 65) [Taxonomy:73481]
Strain A24 Cruzeiro [Taxonomy:12115].
Asia 1 [Taxonomy:110195]
C1 [Taxonomy:12121].
SAT 2 [Taxonomy:35292].
Strain O1 [Taxonomy:73482].

Total RT volume is 33microL containing RNA, 3microg/mL primer 3C3.
RT performed according to recommendations for use of Ready-To-Go You-Prime First STrand Synthesis kit (Pharmacia).

Total PCR volume is 100microL containing cDNA and 2.5ng/microL each primer.
Article does not mention other PCR reagents.
Reverse(3C3 antisense) primer
Oligo type: Degeneracy: 1
Target: 6073-6054Tm: 72 C at salt 1000.0mMLength:
Sequence: GGCCTCACCAGAGAAAATCA
(0 other experimental conditions)
Note:
Forward(3C3 sense) primer
Oligo type: Degeneracy: 1
Target: 5450-5468Tm: 73.7 C at salt 1000.0mMLength:
Sequence: CCACAAGCTGAAGGACCCT
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.