A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BM0325Publication date: 12/00
PMID: 11101603GI: 61076 Taxonomy ID: 73481
Virus Name: Foot-and-mouth disease virus (strain A22/550 AZERBAIJAN 65); foot-and-mouth disease virus C1; Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3; Foot-and-mouth disease virus Asia 1; Foot-and-mouth disease virus (strain O1)Product size (PCR):
bp
MgCl2: 5.5 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):(95C 15sec>60C 60sec)*40
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl
Polymerase: 0.025U/microL Amplitaq Gold DNA poly (PE Applied Biosystems)Cycler:
Note: Strain A22/550 AZERBAIJAN 65 [Taxonomy:73481].
C1 [Taxonomy:12121].
SAT 1 [Taxonomy:12122].
SAT 2 [Taxonomy:35292].
SAT 3 [Taxonomy:12123].
Asia 1 [Taxonomy:110195].
Strain O1 [Taxonomy:73482].

Total RT volume is 10microL containing 50mM KCl, 10mM Tris-HCl (pH 8.3), 5.5mM MgCl2, 0.5mM dNTPs, 2.5microM random hexamers, 0.4U/microL RNase inhibitor, and 2.5U/microL Multiscribe RTase.
Article does not mention RT temperature.

Total PCR volume 50microL containing 1-5microL cDNA and 0.2microM primers.
Forward(IRES2) primer
Oligo type: Degeneracy: 1
Target: 298-318Tm: 74.4 C at salt 1000.0mMLength:
Sequence: CCTGGTCTTTCCAGGTCTAGA
(0 other experimental conditions)
Note:
Reverse(IRES4) primer
Oligo type: Degeneracy: 1
Target: 671-651Tm: 72.5 C at salt 1000.0mMLength:
Sequence: CCTATTCAGGCGTAGAAGCTT
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.