A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BM0309Publication date: 06/98
PMID: 9694330GI: 402536 Taxonomy ID: 12075
Virus Name: Swine vesicular disease virus (isolate Spain1/93); Foot-and-mouth disease virus (strain C1-Santa Pau); Vesicular stomatitis New Jersey virus, VSV NJ; Vesicular stomatitis Indiana virus, VSV IndProduct size (PCR):
bp
MgCl2: 1.5 mMdNTPs: mMType: Multiplex RT-PCR
Temp (PCR cycle):93C 10min>(93C 1min>37C 1min>72C 2min)*30
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl, 0.01% gelatine, 10mM DTT, 0.4U/microL ribonuclease inhibitor, 0.1U/microL AMV RTase
Polymerase: 0.025U/microL Taq Gold poly (Perkin-Elmer, Cetus)Cycler:
Note: Primer set SA2/SS4 is derived from swine vesicular disease virus [Taxonomy:12075], [GI:402536].
Primer set 3D1/3D2 is derived from foot-and-mouth disease virus [Taxonomy:12110], [GI:61076].

Total RT volume is 100microL containing 10mM Tris-HCl (pH 8.3), 50mM KCl, 1.5mM MgCl2, 0.01% gelatine, 10mM DTT, 100mM dNTPs, 0.4U/microL human placenta ribonuclease inhibitor, 2ng/microL each primers SA2 and 3D2, and 0.1U/microL AMV RTase (Seikagaku America).

After 42C for 40min, PCR is performed by adding 2ng/microL each primers 3D1 and SS4 and polymerase to the reaction.

Products seen using this set of four primers and the following viruses:
VSV NJ [Taxonomy:11280].
VSV Ind [Taxonomy:11277].
Strain C1-Santa Pau [Taxonomy:12120].
Isolate Spain1/93 [Taxonomy:12075].

For other RT-PCRs in this article, [see BM0305], [see BM0306], [see BM0307], and [see BM0308].
Forward(3D1) primer
Oligo type: Degeneracy: 1
Target: 6317-6336Tm: 76.1 C at salt 1000.0mMLength:
Sequence: CAGAGATGTGGAAGAGCGCG
(2 other experimental conditions)
Note:
Reverse(3D2) primer
Oligo type: Degeneracy: 1
Target: 6524-6506Tm: 75.8 C at salt 1000.0mMLength:
Sequence: GCGGAACAGCGCTTTGTCC
(2 other experimental conditions)
Note:
Reverse(SA3) primer
Oligo type: Degeneracy: 1
Target: 6271-6250Tm: 76.6 C at salt 1000.0mMLength:
Sequence: TAAGGGTAACCTGCACTGGTGG
(1 other experimental conditions)
Note: Target site found in article (338-359) is different from target site found in BLAST
Forward(SS4) primer
Oligo type: Degeneracy: 1
Target: 6876-6897Tm: 71 C at salt 1000.0mMLength:
Sequence: TTCAGAATGATTGCATATGGGG
(1 other experimental conditions)
Note: Target site found in article (964-985) is different from target site found in BLAST
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.