A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BM0295Publication date: 1998
PMID: 9652063GI: 15216732 Taxonomy ID: 12111
Virus Name: Foot-and-mouth disease virus A; Foot-and-mouth disease virus Asia 1; Foot-and-mouth disease virus C; Foot-and-mouth disease virus O; Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3Product size (PCR):
bp
MgCl2:
mM
dNTPs: mMType: Universal PCR
Temp (PCR cycle):50C 15min>94C 90sec>(94C 30sec>55C 30sec>72C 42sec)*35
Buffer: 100mM Tris-HCl (pH 9.0), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.033U/microL Taq DNA polyCycler: DNA Thermal Cycler
Note: Universal PCR. Primers amplify the following viruses:
Foot-and-mouth disease virus A [Taxonomy:12111]
Foot-and-mouth disease virus Asia 1 [Taxonomy:110195].
Foot-and-mouth disease virus C [Taxonomy:12116].
Foot-and-mouth disease virus O [Taxonomy:12118].
Foot-and-mouth disease virus SAT 1 [Taxonomy:12122].
Foot-and-mouth disease virus SAT 2 [Taxonomy:35292].
Foot-and-mouth disease virus SAT 3 [Taxonomy:12123].

RT-PCR is performed in one tube.
Total volume is 30microL containing 5microL RNA, 0.01microM each primer, and 0.067U/microL AMV-RTase.
Article does not mention the addition of MgCl2.

For other RT-PCR in this article, [see BM0296].
Forward(1C608) primer
Oligo type: Degeneracy: 1
Target: 2834-2853Tm: 74.1 C at salt 1000.0mMLength:
Sequence: AGCGCCGGTAAGGACTTTGA
(0 other experimental conditions)
Note: Mismatch at position 2842.
Reverse(2B58) primer
Oligo type: Degeneracy: 1
Target: 3648-3629Tm: 74.1 C at salt 1000.0mMLength:
Sequence: GACATGTCCTCCTGCATCTG
(3 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.