A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BM0286Publication date: 1996
PMID: 8634024GI: 61076 Taxonomy ID: 12115
Virus Name: Foot-and-mouth disease virus (strain A24 Cruzeiro); foot-and-mouth disease virus C3, Resende; Foot-and-mouth disease virus (strain O1), BFS 1967; Foot-and-mouth disease virus Asia 1, Ind 9/89; Foot-and-mouth disease virus SAT 2, Knp 5/91/2Product size (PCR):
bp
MgCl2: 1.5 mMdNTPs: mMType: Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Taq poly (Promega)Cycler: GeneAmp CR System 9600 (Perkin Elmer)
Note: Multiplex PCR
All primer targets are numbered according to [GI:61076].
Primers P33, P87, P88, P89, P90, P91, and P92 amplify Cruzeiro [Taxonomy:12115].
Primers P33 and P40 amplify Resende [Taxonomy:46290].
Primers P33 and P38 amplify BFS 1967 [Taxonomy:73482].
Primers P33, P74, P75, P76, and P77 amplify Ind 9/89 [Taxonomy:110195].
Primers P33, P55, P56, P57, P58, P59, and P60 amplify Knp 5/91/2 [Taxonomy:35292].

Total RT volume is 10microL containing 50mM Tris-HCl (pH 8.3), 75mM KCl, 3mM MgCl2, 10mM DTT, 0.125mM dNTPs, 5microM primers P33, 10U/microL MMLV RTase (Gibco BRL), and 0.5microg RNA.
RT temperature: 37C 15min>95C 5min.

Total PCR volume is 10microL containing 2microL cDNA and 0.6microM each primers P33, P87, P88, P89, P90, P91, P92, P40, P38, P74, P75, P76, P77, P55, P56, P57, P58, P59, and P60.

For other primers used, [see BM0287].
Reverse(P33) primer
Oligo type: Degeneracy: 1
Target: 3851-3832Tm: 74.1 C at salt 1000.0mMLength:
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:
Forward(P87) primer
Oligo type: Degeneracy: 1
Target: 3124-3147Tm: 78.7 C at salt 1000.0mMLength:
Sequence: GTCATTGACCTCATGCAGACCCAC
(1 other experimental conditions)
Note: Specific to 1D region.
Forward(P88) primer
Oligo type: Degeneracy: 1
Target: 3124-3147Tm: 77 C at salt 1000.0mMLength:
Sequence: GTTATTGACCTCATGCAGACCCAC
(1 other experimental conditions)
Note: Specific to 1D region.
Forward(P89) primer
Oligo type: Degeneracy: 1
Target: 3124-3147Tm: 78.7 C at salt 1000.0mMLength:
Sequence: GTCATTGACCTCATGCACACCCAC
(1 other experimental conditions)
Note: Specific to 1D region.
Forward(P90) primer
Oligo type: Degeneracy: 1
Target: 3124-3147Tm: 77 C at salt 1000.0mMLength:
Sequence: GTCATTGACCTCATGCAGACTCAC
(1 other experimental conditions)
Note: Specific to 1D region.
Forward(P91) primer
Oligo type: Degeneracy: 1
Target: 3124-3147Tm: 77 C at salt 1000.0mMLength:
Sequence: GTCATTGACCTCATGCAAACCCAC
(1 other experimental conditions)
Note: Specific to 1D region.
Forward(P92) primer
Oligo type: Degeneracy: 1
Target: 3124-3147Tm: 75.3 C at salt 1000.0mMLength:
Sequence: GTCATTGACCTTATGCAGACTCAC
(1 other experimental conditions)
Note: Specific to 1D region.
Forward(P40) primer
Oligo type: Degeneracy: 1
Target: 3259-3279Tm: 70.5 C at salt 1000.0mMLength:
Sequence: GTTTCTGCACTTGACAACACA
(1 other experimental conditions)
Note: Target given in article.
Specific to 1D region.
Forward(p38) primer
Oligo type: Degeneracy: 1
Target: 3450-3467Tm: 56 CLength:
Sequence: GCTGCCTACCTCCTTCAA
(2 other experimental conditions)
Note: Specific to 1D region.
Forward(P74) primer
Oligo type: Degeneracy: 1
Target: 3559-3578Tm: 80.2 C at salt 1000.0mMLength:
Sequence: GACACCACTCAGGACCGCCG
(1 other experimental conditions)
Note: Target given in article.
Specific to 1D region.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.