A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BM0285Publication date: 1996
PMID: 8634024GI: 61076 Taxonomy ID: 73482
Virus Name: Foot-and-mouth disease virus (strain O1); Swine vesicular disease virus (STRAIN UKG/27/72); Encephalomyocarditis virus (Belgian isolate 2887A); bovine viral diarrhea virus (isolate NADL)Product size (PCR):
bp
MgCl2: 1.5 mMdNTPs: mMType: Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Taq poly (Promega)Cycler: GeneAmp CR System 9600 (Perkin Elmer)
Note: Multiplex PCR
Primer set P33/P32 is specific to Foot-and-mouth disease virus (strain O1) [Taxonomy:73482], [GI:61076].
Primer set P7/P23 is specific to Swine vesicular disease virus (STRAIN UKG/27/72) [Taxonomy:12077], [GI:61167].
Primer set P5/P6 is specific to Encephalomyocarditis virus (Belgian isolate 2887A) [Taxonomy:12104], [GI:61034].
Primer set P25/P26 is specific to bovine viral diarrhea virus (isolate NADL) [Taxonomy:11100], [GI:323205].

Total RT volume is 10microL containing 50mM Tris-HCl (pH 8.3), 75mM KCl, 3mM MgCl2, 10mM DTT, 0.125mM dNTPs, 5microM each primers P33, P7, P5, and P25, 10U/microL MMLV RTase (Gibco BRL), and 0.5microg RNA.
RT temperature: 37C 15min>95C 5min.

Total PCR volume is 10microL containing 2microL cDNA and 0.6microM each primers P33, P32, P5, P6, P7, P23, P25, and P26.
Reverse(P33) primer
Oligo type: Degeneracy: 1
Target: 3851-3832Tm: 74.1 C at salt 1000.0mMLength:
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:
Forward(P32) primer
Oligo type: Degeneracy: 1
Target: 3721-3740Tm: 74.1 C at salt 1000.0mMLength:
Sequence: CAGATGCAGGAGGACATGTC
(3 other experimental conditions)
Note:
Reverse(P5) primer
Oligo type: Degeneracy: 1
Target: 3417-3394Tm: 80.4 C at salt 1000.0mMLength:
Sequence: GTCGTTCGGCAGTAGGGTTTGAGC
(0 other experimental conditions)
Note:
Forward(P6) primer
Oligo type: Degeneracy: 1
Target: 3208-3229Tm: 78.5 C at salt 1000.0mMLength:
Sequence: CTGGTTCAGAAGGAATGGCCCG
(0 other experimental conditions)
Note:
Reverse(P7) primer
Oligo type: Degeneracy: 1
Target: 3470-3449Tm: 74.7 C at salt 1000.0mMLength:
Sequence: TGCAATCACACCTGGCAATGGT
(0 other experimental conditions)
Note:
Forward(P23) primer
Oligo type: Degeneracy: 1
Target: 3321-3338Tm: 56 CLength:
Sequence: CCGTGTACGTTGGCAACT
(0 other experimental conditions)
Note:
Reverse(P25) primer
Oligo type: Degeneracy: 1
Target: 7255-7235Tm: 78.3 C at salt 1000.0mMLength:
Sequence: CGGGACCTGGACTTCCATAGC
(0 other experimental conditions)
Note:
Forward(P26) primer
Oligo type: Degeneracy: 1
Target: 6941-6960Tm: 74.1 C at salt 1000.0mMLength:
Sequence: GTAGGTAGAGTGAAACCCGG
(1 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.