A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BM0057Publication date: 09/00
PMID: 11014611GI: 2653291 Taxonomy ID: 10320
Virus Name: Bovine herpesvirus 1 Salwa isolate, BHV-1Product size (PCR):
bp
MgCl2: 2.0 mMdNTPs: mMType: PCR
Temp (PCR cycle):94C 9min>(95C 1min>65C 1min>72C 2.5min)*35>72C 7min
Buffer: 1x PCR buffer (Perkin-Elmer Cetus)
Polymerase: 0.02U/microL AmpliTaq Gold DNA poly (Perkin-Elmer)Cycler:
Note: Total PCR volume is 50microL containing 5microL dimethyl sulphoxide (Sigma) and 0.3microM each primer.
Forward(PB00440) primer
Oligo type: Degeneracy: 1
Target: 122330-122350Tm: 84.2 C at salt 1000.0mMLength:
Sequence: CGCCCCACCGCACGACGACAC
(0 other experimental conditions)
Note: Specific to gE gene.
Reverse(PB00441) primer
Oligo type: Degeneracy: 1
Target: 123498-123475Tm: 83.8 C at salt 1000.0mMLength:
Sequence: CAGCCCTACACGCGGGTGCTTTCC
(0 other experimental conditions)
Note: Specific to gE gene.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.