A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BM0055Publication date: 1991
PMID: 9210942GI: 9626649 Taxonomy ID: 11100
Virus Name: bovine viral diarrhea virus (isolate NADL), NADL BVDVProduct size (PCR):
bp
MgCl2: 1.5 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):94C 2min>(94C 1min>55C 1.5min>72C 3min)*30>72C 7min
Buffer: 1x PCR buffer (GeneAmp; Perkin-Elmer Cetus Corp.)
Polymerase: 0.025U/microL Amplitaq poly (Perkin-Elmer Cetus Corp.)Cycler: DNA thermal cycler (Coy Laboratory Products, Inc.)
Note: RT conditions: 1x PCR buffer (GeneAmp; Perkin-Elmer Cetus Corp.), 0.625U/microL RNasin (Promega), 300ng random hexanucleotides, 10U/microL MMLV RTase, and extracted BVDV RNA in a total volume of 20microL.
The RT mixture is incubated at 42C for 45min and then inactivated at 95C for 5min.
All the RT volume is used for PCR.
Total PCR volume is 100microL with 1microM each primer. MgCl2 is included in PCR mixture.
Forward(6322) primer
Oligo type: Degeneracy: 1
Target: 6322-6345Tm: 77 C at salt 1000.0mMLength:
Sequence: CTGCCAAATGCCTCAACCAAAGCT
(2 other experimental conditions)
Note:
Reverse(7451) primer
Oligo type: Degeneracy: 1
Target: 7474-7451Tm: 80.4 C at salt 1000.0mMLength:
Sequence: GGACAACCCGGTCACTTGCTTCAG
(2 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.