A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BM0050Publication date: 04/97
PMID: 9129644GI: 7960755 Taxonomy ID: 61010
Virus Name: Border disease virus strain Moredun cp, BDV cp; Border disease virus strain Moredun ncp, BDV ncp; Hog cholera virus (strain Brescia), CSFV; bovine viral diarrhea virus (isolate NADL), BVDV NADLProduct size (PCR):
bp
MgCl2: 2.5 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):(94C 1min>56C 1min>72C 1min)*35>72C 7min
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl, 0.1mg/mL BSA
Polymerase: 0.02U/microL Taq poly (Perkin Elmer-Cetus)Cycler: Perkin Elmer-Cetus thermocycler
Note: Primers are derived from BVDV NADL [GI:7960755].
These primers are universal for:
BVDV NADL [Taxonomy:11100]
CSFV [Taxonomy:11098]
BDV cp [Taxonomy:61010]
BDV ncp [Taxonomy:60986]
Total RT volume is 25microL containing 4microL extracted RNA, 0.8mM random hexamers (Pharmacia), 1U/microL RNAguard (Pharmacia), 5microL 1st strand reaction buffer (Gibco BRL), 0.2mM each dNTP (Pharmacia), 8U/microL MMLV RTase (Gibco). RT is carried out at 37C for 90min.
Total PCR volume is 50microL containing 4microL cDNA and 0.3microM primers 324 and 326.
Reverse(326) primer
Oligo type: Degeneracy: 1
Target: 395-375Tm: 72.5 C at salt 1000.0mMLength:
Sequence: TCAACTCCATGTGCCATGTAC
(20 other experimental conditions)
Note: Specific to 5' noncoding region.
Forward(324) primer
Oligo type: Degeneracy: 2
Target: 108-128Tm: 73.9 C at salt 1000.0mMLength:
Sequence: ATGCCC(A/T)TAGTAGGACTAGCA
(6 other experimental conditions)
Note: Specific to 5' noncoding region.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.