A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BM0049Publication date: 01/00
PMID: 10590128GI: 2789676 Taxonomy ID: 11099
Virus Name: pestivirus type 1, BVDVProduct size (PCR):
bp
MgCl2: 2.8 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):(94C 30sec>54C 30sec>72C 30sec)*30
Buffer: 28mM Tris-HCl, pH 8.3, 84mM KCl
Polymerase: 0.06U/microL Taq poly (Appligene, Heidelberg, Germany)Cycler:
Note: Author uses BVDV strain Oregon.
RT conditions: 2.5microg total cellular RNA, buffer (27mM Tris-HCl, pH 8.3, 81mM KCl, 2.7mM MgCl2, 0.27mM dNTPs), 0.8microM reverse primer, 0.41U/microL RNA guard (Pharmacia), 1.35U/microL RTase (Superscript, Life Technologies/Bethesda Research Laboratories, Eggenstein, Germany) are heated at 37C for 45min.
For PCR, 5microL PCR mix, 0.7microL upstream primer, and Taq polymerase are added to RT mixture to a total PCR volume of 44.5microL.
Annealing temperature was also tried at 56C and extension time was also tried at 120sec. Author does not give differentiate the results
Forward(BVDV 56) primer
Oligo type: Degeneracy: 1
Target: 4567-4583Tm: 54 CLength:
Sequence: GAGATCTCGGGAGGTAC
(0 other experimental conditions)
Note: Specific to NS2-3 region.
Reverse(BVDV 57) primer
Oligo type: Degeneracy: 1
Target: 5231-5211Tm: 76.4 C at salt 1000.0mMLength:
Sequence: CCTCTCGGCATGATCCCGAAA
(0 other experimental conditions)
Note: Specific to NS2-3 region.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.