A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BM0040Publication date: 03/99
PMID: 10359157GI: 330756 Taxonomy ID: 10320
Virus Name: Bovine herpesvirus 1, BHV-1Product size (PCR):
bp
MgCl2: 2.5 mMdNTPs: mMType: Nested PCR 1
Temp (PCR cycle):(95C 60sec>56C 60sec>72C 60sec)*35>72C 5min
Buffer: 10mM Tris-HCl (pH 8.3) 50mM KCl, 5% (w/v) glycerol
Polymerase: 0.05U/microL Taq DNA polyCycler:
Note: 1microL extracted DNA and 1mM each external primer are used in a total PCR volume of 20microL.
Prior to the addition of Taq and dNTPs, the samples were heated to 98C for 6min.
For secondary PCR, [see BM0041].
Article says that 200mM dNTPs are used.
Forward(Ext F) primer
Oligo type: Degeneracy: 1
Target: 1007-1028Tm: 78.5 C at salt 1000.0mMLength:
Sequence: CACGGACCTGGTGGACAAGAAG
(4 other experimental conditions)
Note: Specific to the gp I glycoprotein region.
Target given in article is 624-645.
Reverse(Ext R) primer
Oligo type: Degeneracy: 1
Target: 1473-1452Tm: 78.5 C at salt 1000.0mMLength:
Sequence: CTACCGTCACGTGAGTGGTACG
(1 other experimental conditions)
Note: Specific to gp I glycoprotein region.
Mismatches at BLAST positions 1460-1457.
Target given in article is 1091-1070.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.