A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BM0039Publication date: 12/96
PMID: 9088554GI: 9626649 Taxonomy ID: 11099
Virus Name: pestivirus type 1Product size (PCR):
bp
MgCl2:
mM
dNTPs: mMType: RT-Nested PCR
Temp (PCR cycle):(94C 1min>56C 2min>72C 2min)*30
Buffer: 1x buffer (Perkin-Elmer Cetus)
Polymerase: 0.025U/microL Taq poly (Perkin-Elmer Cetus)Cycler:
Note: RT conditions: 1x buffer (BRL, Gaithersburg, MD), 8microL RNA, 10mM dithiothreitol (BRL), 0.625U/microL MMLV RTase (BRL) 0.2mM each dNTP (BRL), 0.55U/microL ribonuclease inhibitor (Takara Shuzo, Ltd.), and 0.25microM primer PR1 in a total final RT volume of 40microL are heated at 37C for 90min and then 60C for 10min.
Primary PCR uses 2microL cDNA and 0.4microM each primer PF1 and PR1 in a total final volume of 50microL.
Secondary PCR uses 2microL of primary PCR product and 0.4microM each primers PF2 and PR2 in a total volume of 50microL.
Forward(PF1) primer
Oligo type: Degeneracy: 4
Target: 108-127Tm: Max Tm 74.1 C Min Tm 72 C at salt 1000.0mMLength:
Sequence: ATGCCC(A/T)(C/T)AGTAGGACTAGC
(4 other experimental conditions)
Note:
Reverse(PR1) primer
Oligo type: Degeneracy: 1
Target: 392-373Tm: 72 C at salt 1000.0mMLength:
Sequence: ACTCCATGTGCCATGTACAG
(5 other experimental conditions)
Note:
Forward(PF2) primer
Oligo type: Degeneracy: 2
Target: 190-207Tm: Max Tm 56 C Min Tm 54 CLength:
Sequence: AGTCGTCAGT(A/G)GTTCGAC
(1 other experimental conditions)
Note:
Reverse(PR2) primer
Oligo type: Degeneracy: 1
Target: 343-326Tm: 56 CLength:
Sequence: CTCTGCAGCACCCTATCA
(3 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.