A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BM0001Publication date: 10/98
PMID: 9850996GI: 1850942 Taxonomy ID: 82823
Virus Name: bovine respiratory syncytial virus strain lelystad, BRSV strain LelystadProduct size (PCR):
bp
MgCl2: 2.4 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):98C 10min>(94C 1min>55C 1min>72C 1min)*35
Buffer: 12.5mM Tris-HCl, 51.5mM KCl, 10microg/mL gelatine
Polymerase: 0.025U/microL Taq Poly (Boehringer)Cycler: DNA thermal cycler (Omnigene)
Note: RT buffer: 50mM Tris-HCl, 8mM MgCl2, 30mM KCl, 1mM dithiothreitol, pH 8.5 (Boehringer)
RT Components: 1U/mL RNase inhibitor, 0.625U/mL reverse transcriptase (avian myeloblastosis virus, Boehringer), 1microM G1 primer, 1.75mM dNTPs.
RT conditions: heated 65C 10min, iced 10min, reverse transcriptase added, 42C 30min.
Primers G4 and F4, or G1 and G4 (5 nM each) were used for each PCR.
Forward(G1) primer
Oligo type: PCRDegeneracy: 1
Target: 1-15Tm: 83.7 C at salt 1000.0mMLength:
Sequence: GCCCGGATCCATGTCCACCCATACC
(0 other experimental conditions)
Note: Not found on BLAST. Author used strain Lelystad.
Used in RT.
Used also in combination with F4 in PCR.
Reverse(F4) primer
Oligo type: PCRDegeneracy: 1
Target: 673-656Tm: 50 CLength:
Sequence: GACACTATCTTAAGGTTC
(0 other experimental conditions)
Note: Used in combination with G4 or G1 in PCR.
Forward(G4) primer
Oligo type: PCRDegeneracy: 1
Target: 273-288Tm: 48 CLength:
Sequence: CACAGAGCACAACTAC
(0 other experimental conditions)
Note: Used in combination with F4 in PCR.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.