A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BH0066Publication date: 07/94
PMID: 7933281GI: 58575 Taxonomy ID: 35252
Virus Name: Alcelaphine herpesvirus 1, AHV-1; Alcelaphine herpesvirus 2, AHV-2Product size (PCR):
bp
MgCl2: 1.5 mMdNTPs: mMType: Universal PCR
Temp (PCR cycle):(94C 0.5min>50C 1min>70C 5min)*34>72C 10min
Buffer: 10mM Tris (pH 8.3), 50mM KCl, 100ng/microL gelatin
Polymerase: 0.02U/microL Taq DNA poly (Perkin-Elmer Cetus)Cycler:
Note: Universal PCR. Primers amplify AHV-1 [Taxonomy:35252] and AHV-2 [Taxonomy:138184].

Primers do not amplify bovine herpesvirus 1, bovine herpesvirus 2, human cytomegalovirus, or Epstein-Barr virus.

Total PCR volume is 100microL containing 10ng/microL sample DNA and 2.5ng/microL each primer.
Before the polymerase is added, the mixture is heated to 100C 3min>50C>25C.

PCR products are transferred and fixed to a nylon membrane for Southern blot hybridization.
Blots are prehybridized in 5mL hybridization buffer (Sigma Chemical Co.) at 50C 30min. Hybridization is performed by adding probe BH00660.
Hybridization temperature: 50C 1hr.
Forward(BH00660) primer
Oligo type: HybridizationDegeneracy: 1
Target: 101-127Tm: 80.5 C at salt 1000.0mMLength:
Sequence: TCGCCTCTTAGGGTGAAGACAGCTACT
(1 other experimental conditions)
Note: Specific to AHV-1.
Forward(A) primer
Oligo type: Degeneracy: 1
Target: 1-30Tm: 79.3 C at salt 1000.0mMLength:
Sequence: ATACATGTCATTTAAGACACCCACGCACCA
(1 other experimental conditions)
Note:
Reverse(B) primer
Oligo type: Degeneracy: 1
Target: 201-172Tm: 79.3 C at salt 1000.0mMLength:
Sequence: CTGGTGCAGGATGACCACAATTTTACTATC
(1 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.