A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BH0057Publication date: 12/98
PMID: 9850544GI: 902376 Taxonomy ID: 54315
Virus Name: Bovine viral diarrhea virus-2, BVDV2; Bovine viral diarrhea virus (isolate NADL), BVDV-NADLProduct size (PCR):
bp
MgCl2: 1.5 mMdNTPs: mMType: RT-Nested PCR
Temp (PCR cycle):94C 2min>(94C 30sec>50C 45sec>72C 60sec)*30>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.05U/microL Taq polyCycler:
Note: PN00423/PN00424 is derived from BVDV-NADL [GI:9626649], [Taxonomy:11100].
PN00425/PN00426 is derived from BVDV2 [GI:902376], [Taxonomy:54315].

Single-step RT and primary PCR is performed in 50microL containing 20mM Tris-HCl (pH 8.4), 50mM KCl, 1.5mM MgCl2, 4-8ng/microL RNA sample, 2.0microM each primers PN00423 and PN00424, 0.2mM each dNTP, 0.05U/microL Taq poly, 4U/microL MMLV RTase, and 0.15U/microL RNase inhibitor.
RT-PCR cycle: 42C 1hr>94C 3min>(94C 30sec>50C 45sec>72C 60sec)*30>72C 10min.

Total secondary PCR volume is 50microL containing 2-3microL primary PCR product and 2.0microM each primers PN00426 and PN00425.
Forward(PN00423) primer
Oligo type: Degeneracy: 1
Target: 188-205Tm: 56 CLength:
Sequence: GTAGTCGTCAGTGGTTCG
(3 other experimental conditions)
Note: Used with PN00424, [GI:9626649], in primary PCR.
Reverse(PN00424) primer
Oligo type: Degeneracy: 1
Target: 383-366Tm: 54 CLength:
Sequence: GCCATGTACAGCAGAGAT
(3 other experimental conditions)
Note: Used with PN00423, [GI:9626649], in primary PCR.
Forward(PN00426) primer
Oligo type: Degeneracy: 1
Target: 204-223Tm: 72 C at salt 1000.0mMLength:
Sequence: CGACACTCCATTAGTTGAGG
(4 other experimental conditions)
Note: Used with PN00425, [GI:902376], in secondary PCR.
Reverse(PN00425) primer
Oligo type: Degeneracy: 1
Target: 320-301Tm: 72 C at salt 1000.0mMLength:
Sequence: GTCCATAACGCCACGAATAG
(4 other experimental conditions)
Note: Used with PN00426, [GI:902376], in secondary PCR.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.