A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BH0056Publication date: 04/93
PMID: 8391540GI: 61076 Taxonomy ID: 12118
Virus Name: Foot-and-mouth disease virus O, FMDVProduct size (PCR):
bp
MgCl2: 1.5 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):100C 2min>(94C 30sec>60C 30sec>72C 120sec)*30
Buffer: 66mM Tris-HCl (pH 8.8), 16.6mM (NH4)2SO4, 10mM beta-mercaptoethanol, 8.4ng/microL BSA
Polymerase: 0.04U/microL polyCycler: Intelligent Heating Block (Hybaid)
Note: Total RT volume is 50microL containing 2.0microM primer P1, 6mM MgCl2, 5mM each dNTP, 50mM Tris-HCl (pH 8.3), 40mM KCl, 10mM DTT, 100ng/microL BSA, 1U/microL RNasin (Boehringer Mannheim UK Ltd), and 0.326U/microL AMV RTase (Life Sciences Inc).
RT temperature: 42C 1hr>100C 2min

Total PCR volume is 50microL containing 2.0microM each primer in a set (P1/P2 or P1/P3) and 5microL cDNA.
Taq polymerase (Cambio UK Ltd.) or AmpliTaq polymerase (Perkin-Elmer Cetus) is added at the end of the 60C annealing step of the first cycle.
Reverse(P1) primer
Oligo type: PCRDegeneracy: 1
Target: 3578-3558Tm: 80.3 C at salt 1000.0mMLength:
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in BLAST differs than that given in article (3592-3572).
Forward(P2) primer
Oligo type: Degeneracy: 1
Target: 1488-1511Tm: 75.3 C at salt 1000.0mMLength:
Sequence: CACACAACCAACACCCAGAACAAT
(0 other experimental conditions)
Note: Target found in BLAST differs than that given in article (1502-1525).
Forward(P3) primer
Oligo type: Degeneracy: 1
Target: 3363-3382Tm: 74.1 C at salt 1000.0mMLength:
Sequence: CCTACCTCCTTCAACTACGG
(2 other experimental conditions)
Note: Target found in BLAST differs than that given in article (3377-3396).
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.