A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BH0049Publication date: 09/95
PMID: 8593411GI: 7960753 Taxonomy ID: 11100
Virus Name: Bovine viral diarrhea virus (isolate NADL), BVDV; Hog cholera virus (strain Brescia), HCVProduct size (PCR):
bp
MgCl2: 1.5 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):94C 75sec>(94C 45sec>60C 60sec>72C 60sec)*35>72C 6min
Buffer: 2mM Tris-HCl (pH 8.3), 26mM KCl, 0.6mM ethyleneglycoltetraacetic acid, 4% glycerol, 0.04% Tween 20
Polymerase: 0.025U/microL recombinant Tth DNA polyCycler:
Note: Universal PCR. Primers amplify the following viruses:
BVDV [Taxonomy:11100]
HCV [Taxonomy:11098]

Total RT volume is 20microL containing 1mM MnCl2, 0.125U/microL recombinant Tth DNA polymerase, 0.25mM each dNTP, 10mM Tris-HCl (pH 8.3), 90mM KCl, and 1.5microM primer P3.
RT temperature: 70C 10min

Total PCR volume is 100microL containing 20microL cDNA and 0.3microM each primer.
Article does not mention addition of dNTP, Tris-HCl, primer P3, or polymerase in PCR.
Forward(P1) primer
Oligo type: Degeneracy: 1
Target: 98-118Tm: 76.4 C at salt 1000.0mMLength:
Sequence: GAGGCTAGCCATGCCCTTAGT
(3 other experimental conditions)
Note:
Reverse(P3) primer
Oligo type: Degeneracy: 1
Target: 395-371Tm: 77.2 C at salt 1000.0mMLength:
Sequence: TCAACTCCATGTGCCATGTACAGCA
(1 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.