A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BH0045Publication date: 11/97
PMID: 9491443GI: 9626649 Taxonomy ID: 11099
Virus Name: Pestivirus type 1Product size (PCR):
bp
MgCl2: 2.5 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>56C 1min>72C 1min)*35>72C 10min
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl
Polymerase: 0.025U/microL AmpliTaq DNA poly (Perkin-Elmer Cetus)Cycler: Programmable Thermal Controller (MJ Research Inc)
Note: Total RT volume is 40microL containing 1.0microM primer PEST2, 2.5mM MgCl2, 1mM each dNTP, 10mM Tris-HCl (pH 8.3), 50mM KCl, 1.25U/microL MMLV RTase (Perkin-Elmer Cetus), and 0.5U/microL RNase inhibitor (Perkin-Elmer Cetus).
RT temperature: 37C 60min>98C 10min

Total PCR volume is 100microL containing 0.4microM each primer and all 40microL cDNA.
Article does not mention addition of primer PEST2 in PCR.
Forward(PEST1) primer
Oligo type: Degeneracy: 1
Target: 324-343Tm: 76.1 C at salt 1000.0mMLength:
Sequence: CCTGATAGGGTGCTGCAGAG
(1 other experimental conditions)
Note:
Reverse(PEST2) primer
Oligo type: Degeneracy: 1
Target: 395-375Tm: 72.5 C at salt 1000.0mMLength:
Sequence: TCAACTCCATGTGCCATGTAC
(20 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.