A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BH0044Publication date: 07/99
PMID: 10391508GI: 330756 Taxonomy ID: 35244
Virus Name: Bovine herpesvirus 5Product size (PCR):
bp
MgCl2: 1.5 mMdNTPs: mMType: Nested PCR
Temp (PCR cycle):(94C 45sec>57C 60sec>72C 60sec)*5>(94C 45sec>53C 60sec>72C 60sec)*30
Buffer: 10mM Tris-HCl (pH 9.0), 50mM KCl, 0.1% BSA
Polymerase: 0.02U/microL Taq DNA poly (Perkin Elmer Cetus)Cycler: DNA Thermal Cycler (Perkin Elmer)
Note: Total primary PCR volume is 50microL containing 5microL sample DNA and 0.3microM each primers OIBR21A and OIBR22.

Total secondary PCR volume is 50microL containing 1microL primary PCR product and 0.3microM each primers OIBR24A and OIBR23A.
Secondary PCR conditions are identical to those of primary PCR.
Forward(OIBR21A) primer
Oligo type: Degeneracy: 1
Target: 1200-1219Tm: 80.2 C at salt 1000.0mMLength:
Sequence: CTCTACCGCACGGGCACCTC
(0 other experimental conditions)
Note: Used with OlBR22 in primary PCR.
Reverse(OIBR22) primer
Oligo type: Degeneracy: 1
Target: 1554-1533Tm: 76.6 C at salt 1000.0mMLength:
Sequence: TCTCGTCTCGCAGCATTTCGTC
(0 other experimental conditions)
Note: Used with OlBR21A in primary PCR.
Forward(OIBR24A) primer
Oligo type: Degeneracy: 1
Target: 1227-1248Tm: 76.6 C at salt 1000.0mMLength:
Sequence: TGCATCGTGGAAGAAGTGGAGG
(0 other experimental conditions)
Note: Used with OlBR23A in secondary PCR.
Reverse(OIBR23A) primer
Oligo type: Degeneracy: 1
Target: 1487-1468Tm: 80.2 C at salt 1000.0mMLength:
Sequence: CACCCAGTCCCAGGCTACCG
(0 other experimental conditions)
Note: Used with OlBR24A in secondary PCR.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.