A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BH0010Publication date: 07/01
PMID: 11376844GI: 9626649 Taxonomy ID: 11099
Virus Name: pestivirus type 1Product size (PCR):
bp
MgCl2: 1.25 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):(95C 45sec>50C 60sec>72C 60sec)*35
Buffer: reaction buffer (Biozym, Hess, Germany)
Polymerase: 0.025U/microL Tth poly (Biozym)Cycler:
Note: Universal PCR.
Primers E2f, E2inf, and E2r are specific to the E2 glycoprotein gene of pestivirus type 1.
The primer pair E2f/E2r amplified all pestivirus type 1 isolates except [Taxonomy:145171] and [Taxonomy:145220]. Primer set E2inf/E2r is used to amplify these two pestiviruses.

Total RT volume is 40microL containing 2mM dithiothreitol, 10mg/microL random hexamers, 0.125U/microL RNase inhibitor (Gibco BRL), 10U/microL MMLV RTase (Gibco BRL), and 0.08mM dNTPs.
RNA is denatured for 5min at 70C before the addition of RTase.
RT temperature: 22C 5min>37C 15min>42C 30min>99C 5min.

Total PCR volume is 100microL containing 8microL cDNA and 0.01microM each primer in a set.
Article does not mention amount of buffer used.
Forward(E2f) primer
Oligo type: Degeneracy: 2
Target: 2754-2774Tm: Max Tm 70.5 C Min Tm 68.5 C at salt 1000.0mMLength:
Sequence: ACTTTGAATTTGGACT(C/T)TGCC
(0 other experimental conditions)
Note:
Forward(E2inf) primer
Oligo type: Degeneracy: 1
Target: 2825-2846Tm: 80.3 C at salt 1000.0mMLength:
Sequence: AACGGACCGGCCTTCCAGATGG
(0 other experimental conditions)
Note:
Reverse(E2r) primer
Oligo type: Degeneracy: 2
Target: 3453-3434Tm: Max Tm 70 C Min Tm 67.9 C at salt 1000.0mMLength:
Sequence: TCCAGGTCAAACCA(A/G)TATTG
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.