A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BH0008Publication date: 06/95
PMID: 8600434GI: 10140926 Taxonomy ID: 35252
Virus Name: Alcelaphine herpesvirus 1, AHV-1Product size (PCR):
bp
MgCl2: 1.5 mMdNTPs: mMType: Nested PCR
Temp (PCR cycle):97C 3min>62C 0sec>72C 1min>(93C 40sec>62C 30sec>72C 60sec)*33>72C 5min
Buffer: 10mM Tris-HCl (pH 9.0), 50mM KCl, 1% Triton X-100
Polymerase: 0.03U/microL Taq DNA poly (Promega)Cycler:
Note: Total PCR volume is 50microL containing 5microL DNA and 0.4microM each primer.
Polymerase is added after initial 97C 3min at 62C.
Forward(MC1) primer
Oligo type: Degeneracy: 1
Target: 39502-39527Tm: 77.3 C at salt 1000.0mMLength:
Sequence: GATAGCACTCATGTCTGTGAATGTGG
(0 other experimental conditions)
Note:
Reverse(MC2) primer
Oligo type: Degeneracy: 1
Target: 40110-40085Tm: 77.3 C at salt 1000.0mMLength:
Sequence: GTGTAGTTATTGCTTGTGCTCCCGTA
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.