A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BH0007Publication date: 1994
PMID: 7979973GI: 10140926 Taxonomy ID: 35252
Virus Name: Alcelaphine herpesvirus 1, AHV1Product size (PCR): 413 bp
MgCl2: 1.5 mMdNTPs: mMType: PCR
Temp (PCR cycle):95C 2min>(95C 1min>56C 2min>74C 2min)*30>74C 10min
Buffer: 50mM Tris-HCl (pH 9.0), 20mM ammonium sulfate
Polymerase: 0.05U/microL Tub polyCycler: PHC-3 Dri-Block Cycler (Techne)
Note: Total PCR volume is 50microL containing 10microL DNA template and 1.0microM each primer.

Southern blot hybridization is performed as described by Tham et al, (1991) [PMID:1850950] using probe B2.b.
Reverse(B2.2) primer
Oligo type: Degeneracy: 1
Target: 40028-40008Tm: 72 C at salt 1000.0mMLength:
Sequence: AATCGAGCGAAGGTGTGTGT
(0 other experimental conditions)
Note: Sequence given in article is missing a "C" between positions 40015 and 40017.
Forward(B2.1) primer
Oligo type: Degeneracy: 1
Target: 39615-39634Tm: 70 C at salt 1000.0mMLength:
Sequence: TCAATGCAGCTTACTGTGCT
(0 other experimental conditions)
Note:
Reverse(B2.b) primer
Oligo type: Degeneracy: 1
Target: 39784-39761Tm: 75.3 C at salt 1000.0mMLength:
Sequence: GTCACTGAGAGTTACCAACATACG
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.