A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: BH0004Publication date: 10/94
PMID: 7858018GI: 58575 Taxonomy ID: 35252
Virus Name: Alcelaphine herpesvirus 1, AHV-1Product size (PCR):
bp
MgCl2: 1.5 mMdNTPs: mMType: PCR
Temp (PCR cycle):(94C 1min>55C 1min>72C 3min)*35>72C 10min
Buffer: 10mM Tris (pH 8.3), 50mM KCl
Polymerase: 0.025U/microL Taq DNA poly (Perkin Elmer Cetus)Cycler:
Note: Total PCR volume is 100microL containing 10ng/microL DNA and 0.02microM each primer.

PCR products are transferred and fixed to a nylon membrane (Hybond-N; Amersham) for Southern blot hybridization. Blots are prehyridized at 42C 2hr in 5x SSC, 0.1% N-lauroylsarcosine, 0.02% SDS, 1% blocking reagent. For hybridization, 1.0nM probe is added.
Hybridization temperature: 42C 1hr
Forward(A) primer
Oligo type: Degeneracy: 1
Target: 1-30Tm: 79.3 C at salt 1000.0mMLength:
Sequence: ATACATGTCATTTAAGACACCCACGCACCA
(1 other experimental conditions)
Note:
Reverse(B) primer
Oligo type: Degeneracy: 1
Target: 201-172Tm: 79.3 C at salt 1000.0mMLength:
Sequence: CTGGTGCAGGATGACCACAATTTTACTATC
(1 other experimental conditions)
Note:
Forward(PN00089) primer
Oligo type: Degeneracy: 1
Target: 101-127Tm: 80.5 C at salt 1000.0mMLength:
Sequence: TCGCCTCTTAGGGTGAAGACAGCTACT
(1 other experimental conditions)
Note: Used as probe for the Southern blot hybridization.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.