A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: AM0019Publication date: 08/98
PMID: 9880007GI: 2117036 Taxonomy ID: 11246
Virus Name: Bovine respiratory syncytial virus, BRSV Product size (PCR): 417 bp
MgCl2: 2.18 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):(94C 1min>60C 1min>72C 90sec)*35>72C 5min30sec
Buffer: 10mM Tris-HCl[pH 9.0], 50mM KCl
Polymerase: 0.02U/microL Taq poly(Perkin Elmer)Cycler: Perkin Elmer Thermocyclers
Note: RT was performed in a reaction mixture of 25microL final volume as described previously by Vilcek et al, 1994 [PMID: 7814551].
PCR amplifications were performed in a final volume of 50 microL with primer concentration of 0.3 microM.
MgCl2 concentration in PCR amplification was from 1.62mM to 2.74mM, depending on the amount of cDNA used for amplification(2-4microL) and MgCl2 quantity added during PCR(3-5microL).
2 PCRs were performed in this article using previously published primers, which amplified nucleotide sequences of G protein and F protein of BRSV.
Primers B1 and B4A, were described previously by Vilcek et al. [PMID: 7814551], amplified a 493bp region from the F protein gene of BRSV.
Primers G1 and G2, described previously by Stine et al. [PMID: 9100323], amplified a 731bp region from the G protein gene of BRSV.
The end of the G protein gene was amplified by combining primers B7A from the G gene and primer F1 located in the 5' end of the F gene.
Forward(B7A) primer
Oligo type: PCRDegeneracy: 1
Target: 308-332Tm: 77.2 C at salt 1000.0mMLength:
Sequence: CATCAATCCAAAGCACCACACTGTC
(3 other experimental conditions)
Note: Primer from the G gene.
GI # 2117036.
Reverse(F1) primer
Oligo type: PCRDegeneracy: 1
Target: 28-12Tm: 86.8 C at salt 1000.0mMLength:
Sequence: CACGGATCCGGCTGTTGCCGCCATCC
(0 other experimental conditions)
Note: Primer from the 5' end of the F gene.
BLAST resulted in a mismatch of the first 9 nucleotides from the 5' end.
GI # 210828.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.