A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: AM0017Publication date: 04/96
PMID: 8908748GI: 209938 Taxonomy ID: 10546
Virus Name: Bovine adenovirus, BAV; Ovine adenovirus, OAV; Porcine adenovirus, PAVProduct size (PCR): 301 bp
MgCl2: 1.5 mMdNTPs: mMType: PCR
Temp (PCR cycle):94C 9.5min>(94C 30sec>55C 30sec>72C 30sec)*35>72C 4.5min
Buffer: 50mM KCl, 10mM Tris-HCl [pH 9.0]
Polymerase: 0.02U/microL Taq polyCycler: DNA Thermal Cycler(Perkin Elmer Cetus) or PDR 91 DNA reproducer(BLS Ltd.)
Note: 1microM each primer and 1-5microL of target DNA are used in a total PCR volume of 50microL.
Forward(HexAdB) primer
Oligo type: PCRDegeneracy: 4
Target: 67-91Tm: Max Tm 82.1 C Min Tm 78.8 C at salt 1000.0mMLength:
Sequence: GCCGCA(A/G)TGGTC(T/C)TACATGCACATC
(0 other experimental conditions)
Note:
Reverse(HexAdJ) primer
Oligo type: PCRDegeneracy: 16
Target: 367-345Tm: Max Tm 82.2 C Min Tm 75 C at salt 1000.0mMLength:
Sequence: CAGC(A/G)(C/T)(G/A)CCGCGGATGTCAAA(A/G)T
(0 other experimental conditions)
Note:
Reverse(HexAA1913) primer
Oligo type:
Degeneracy: 1
Target: 19158-19136Tm: 80.4 C at salt 1000.0mMLength:
Sequence: CAGCACGCCGCGGATGTCAAAGT
(18 other experimental conditions)
Note: This is the original primer.
GI: 9626158.
Reverse() primer
Oligo type: PCRDegeneracy: 16
Target: 19158-19136Tm: Max Tm 82.2 C Min Tm 75 C at salt 1000.0mMLength:
Sequence: CAGC(A/G)(C/T)(G/A)CCGCGGATGTCAAA(G/A)T
(0 other experimental conditions)
Note: This is the modified primer for HexAA1913. The original primer was altered by introducing wobbles at positions 5, 6, 7 & 22.
GI: 9626158.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.