A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: AM0007Publication date: 02/93
PMID: 8388400GI: 330756 Taxonomy ID: 10320
Virus Name: Bovine herpesvirus 1, BHV-1Product size (PCR): 468 bp
MgCl2: N/A mMdNTPs: mMType: Hybridization
Temp (PCR cycle):56C 18hr
Buffer:
Polymerase: 4U/microL Taq poly(Perkin-Elmer)Cycler:
Note: Filters were prehybridised in 6 X SSC, 0.5% SDS, 0.1% BSA, 5 X Denhardts, 100 microL/1mL denatured salmon sperm DNA for 3h @ 56C. Hybridization was carried out in the same solution, only salmon sperm DNA was substituted with 32P-probe. Filter was incubated @ 56C 18h, then washed in 1 X SSC +0.5% SDS 15min @ 20C> 1 X SSC +0.1% SDS 15min @ 20C> (0.1 X SSC +0.5% SDS 20min @56C)*3. The radioactive probe was detected using autoradiography on the rtg film. 32 P-probe (oligomer was labeled with [y-32 P] ATP and T4 polynucleotide kinase, Amersham). This experiment is done after PCR(AM0006). No hybridization condition was found.
Forward(AM00071) primer
Oligo type: HybridizationDegeneracy: 1
Target:
-
Tm: 82.2 C at salt 1000.0mMLength:
Sequence: GTACGGGTACACCGAGCGCGC
(1 other experimental conditions)
Note: BLAST did not result in a BVDV virus sequence.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.